Sequence ID | >SRA1016175 |
Genome ID | SRR023846.380322 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 174 |
End posion on genome | 98 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgaccggtgt |
tRNA gene sequence |
AGGGGAGTCGCCAAGCTGGTTAAGGCACCGGATTTTGATTCCGGCATGCGAAGGTTCGAA |
Downstream region at tRNA end position |
aatattcacc |
Secondary structure (Cloverleaf model) | >SRA1016175 Gln TTG t GCCA aatattcacc A - T G - C G - C G - C G - C A - T G + T T A T C T T C C A C G A C | | | | | G T A C C G G A A G G C G | | | T T G A G G C T T A A CATGC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |