Sequence ID | >SRA1016187 |
Genome ID | SRR023846.389028 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 149 |
End posion on genome | 238 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gcgcgccgtt |
tRNA gene sequence |
GGAGAGATGCCGGAGTGGCCGAACGGGACGGATTCGAAATCCGTTGTACTGGCGACAGTA |
Downstream region at tRNA end position |
tacaaatgaa |
Secondary structure (Cloverleaf model) | >SRA1016187 Ser CGA t GCCA tacaaatgaa G - C G - C A - T G - C A - T G - C A - T T A T A T C C C A T G A G | | | | | A G G G C C T A G G G C G | | | T T C A C G G C G A G TGTACTGGCGACAGTACC A - T C - G G - C G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |