Sequence ID | >SRA1016212 |
Genome ID | SRR023846.405038 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 111 |
End posion on genome | 27 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcctcgctta |
tRNA gene sequence |
GGAGAGGTTCCCGAGCGGCCAAAGGGATCAGACTGTAAATCTGACGTCTACGACTTCGAA |
Downstream region at tRNA end position |
gatttagcgc |
Secondary structure (Cloverleaf model) | >SRA1016212 Tyr GTA a ACCA gatttagcgc G - C G - C A - T G - C A C G - C G - C T A T C T T C C A C G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A A CGTCTACGACTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |