Sequence ID | >SRA1016276 |
Genome ID | SRR023846.431452 |
Search identical group | |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 235 |
End posion on genome | 149 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gctcctcgtc |
tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCGCCAGCTTCAGGTGCTGGTACTCGAAAGGGTGTG |
Downstream region at tRNA end position |
ttccattttt |
Secondary structure (Cloverleaf model) | >SRA1016276 Leu CAG c ACCA ttccattttt G - C C - G C - G C - G A - T G - C A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TACTCGAAAGGGTGT C - G C - G A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |