Sequence ID | >SRA1016301 |
Genome ID | SRR023846.439975 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 56 |
End posion on genome | 131 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gctcaaaagt |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
attaatgatg |
Secondary structure (Cloverleaf model) | >SRA1016301 Lys TTT t ACCA attaatgatg G - C G - C G - C T - A C - G G - C T - A T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |