Sequence ID | >SRA1016305 |
Genome ID | SRR023846.442705 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 227 |
End posion on genome | 154 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgcccaccgg |
tRNA gene sequence |
GGCGGGGTAGCTCAGTTGGTAGAGCAAACGGCTCATAATCGTTGTGTCGCGGGTTCAAGT |
Downstream region at tRNA end position |
ggtccgactg |
Secondary structure (Cloverleaf model) | >SRA1016305 Met CAT g ACgc ggtccgactg G + T G - C C - G G - C G + T G - C G - C T G T C G C C C A T G A A | | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A GTGTC A - T A - T C - G G - C G + T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |