Sequence ID | >SRA1016311 |
Genome ID | SRR023846.444410 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 81 |
End posion on genome | 155 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
caaaggacac |
tRNA gene sequence |
GCTTCCGTAGTTCAATGGATAGAATTTCGGTTTCCGGTACCGACGATAGGGGTTCGAATC |
Downstream region at tRNA end position |
gcaaaagcct |
Secondary structure (Cloverleaf model) | >SRA1016311 Arg CCG c ACAA gcaaaagcct G - C C - G T - A T + G C - G C - G G - C T A T T T C C C A T A A A | + | | | G G C T T G A G G G G C G | | | + T T A G A A T T A T CGAT T - A C - G G - C G - C T - A T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |