Sequence ID | >SRA1016337 |
Genome ID | SRR023846.457634 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 222 |
End posion on genome | 148 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gccggcgaca |
tRNA gene sequence |
CGGGCGGTAGCTCAGCCGGTTAGAGCAGTCGACTCATAATCGATCGGTCACGGGTTCAAG |
Downstream region at tRNA end position |
ccgagctgat |
Secondary structure (Cloverleaf model) | >SRA1016337 Met CAT a ACtt ccgagctgat C T G - C G - C G - C C - G G - C G - C T G T T G C C C A C G A A | | | | | A C C T C G A C G G G C G | | | | T T G G A G C T T A A CGGTC G + T T - A C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |