Sequence ID | >SRA1016353 |
Genome ID | SRR023846.461497 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 266 |
End posion on genome | 191 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aacgggaatc |
tRNA gene sequence |
TGTCCGATGGTGTAACTGGCAACACGCTTGATTTTGATTCAAGAAAGTCCAGGTTCGAGC |
Downstream region at tRNA end position |
agtacctcga |
Secondary structure (Cloverleaf model) | >SRA1016353 Gln TTG c ACGA agtacctcga T - A G - C T - A C - G C - G G - C A - T C G T G G T C C A C A A G | | | | | G T T G T G C C A G G C G | | | | T T G A C A C C A G AAAGT C - G T - A T - A G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |