Sequence ID | >SRA1016360 |
Genome ID | SRR023846.465192 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 248 |
End posion on genome | 173 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
acgatggcgg |
tRNA gene sequence |
GGGTCCGTAGCTCAGTTGGTAGAGCAAGCGACTTTTAATCGAGAGGTCCCGGGTTCGAGC |
Downstream region at tRNA end position |
tcgatgcctc |
Secondary structure (Cloverleaf model) | >SRA1016360 Lys TTT g ACCA tcgatgcctc G - C G - C G - C T - A C - G C - G G - C C G T G G C C C A T G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A AGGTC A G G A C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |