Sequence ID | >SRA1016376 |
Genome ID | SRR023846.470861 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 126 |
End posion on genome | 36 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cccgtgttgc |
tRNA gene sequence |
GGAGAGCTGGCCGAGTGGCCGAAGGCGCTCCCCTGCTAAGGGAGTACACCTCAAAAGGGT |
Downstream region at tRNA end position |
ttatttgtgt |
Secondary structure (Cloverleaf model) | >SRA1016376 Ser GCT c GCCA ttatttgtgt G - C G - C A - T G - C A - T G + T C - G T A T C C C C C A T G A G | | | | | G G G C C G G G G G G C G | | | T T C A G G C C G A G TACACCTCAAAAGGGTGTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |