Sequence ID | >SRA1016383 |
Genome ID | SRR023846.473055 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 117 |
End posion on genome | 193 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gaataaacgc |
tRNA gene sequence |
AGGCGCGTAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
actcaccctt |
Secondary structure (Cloverleaf model) | >SRA1016383 Val GAC c ACCA actcaccctt A - T G - C G - C C - G G - C C - G G - C T A T T A A C C A T G A A + | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |