Sequence ID | >SRA1016459 |
Genome ID | SRR023846.508664 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 245 |
End posion on genome | 170 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcggtgttga |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCGGCGGTCTCCAAAACCGCAGGTCGTAAGTTCGAGC |
Downstream region at tRNA end position |
ttcctcacca |
Secondary structure (Cloverleaf model) | >SRA1016459 Trp CCA a GCCA ttcctcacca A - T G - C G - C G - C G - C T + G A - T C G T C A T T C A T G A A | | | | | G T C T C G G T A A G C G | | | | T T G G A G C T A G AGGTC G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |