Sequence ID | >SRA1016486 |
Genome ID | SRR023846.526333 |
Search identical group | |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 118 |
End posion on genome | 42 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cccctcacgt |
tRNA gene sequence |
GCCGCCGTAGCTCAGTTGGTTAGAGCACTAGATTGTGGATCTAGGGGTCCCCCGTTCGAG |
Downstream region at tRNA end position |
tcgaatttcg |
Secondary structure (Cloverleaf model) | >SRA1016486 His GTG t ACCA tcgaatttcg G + T C - G C - G G + T C - G C - G G - C C G T G G G G C A T G A A | | | | | G T C T C G C C C C G C G | | | | T T G G A G C T T A A GGGTC C - G T - A A - T G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |