Sequence ID | >SRA1016547 |
Genome ID | SRR023846.558063 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 142 |
End posion on genome | 67 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
caaacctcaa |
tRNA gene sequence |
GCGAGAGTAGCTCAGTTGGTAGAGCGCGACCTTGCCAAGGTCGAGGTCGCGAGTTCGAAC |
Downstream region at tRNA end position |
gactcaaaac |
Secondary structure (Cloverleaf model) | >SRA1016547 Gly GCC a TCCA gactcaaaac G - C C - G G - C A C G - C A - T G - C C A T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |