Sequence ID | >SRA1016552 |
Genome ID | SRR023846.560909 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 134 |
End posion on genome | 208 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gcgaagacat |
tRNA gene sequence |
CGGGGTGTGGCGCAGCTTGGTAGCGCGCCTCGTTCGGGACGAGGAGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
gaaattggtc |
Secondary structure (Cloverleaf model) | >SRA1016552 Pro CGG t ACac gaaattggtc C - G G - C G - C G - C G - C T - A G + T T A T C G C C C A C G A G | + | | | G T C G C G G T G G G C T | | | | T T G G C G C G T A G AGGTC C - G C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |