Sequence ID | >SRA1016565 |
Genome ID | SRR027217.1945 |
Phylum/Class | Diversity of active microbial communities in surface seawaters along a north-south transect in the South Pacific Ocean (SRP001207) |
Species | |
Start position on genome | 154 |
End posion on genome | 230 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gcgcacggtc |
tRNA gene sequence |
CGGGGCGTGGCGCAGTCTGGTAGCGCACCTGTTTTGGGTACAGGGGGTCGTGAGTTCGAA |
Downstream region at tRNA end position |
cttcttcttt |
Secondary structure (Cloverleaf model) | >SRA1016565 Pro TGG c ACCA cttcttcttt C - G G - C G - C G - C G - C C - G G - C T A T C G C T C A T G A G | + | | | G C C G C G G T G A G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |