| Sequence ID | >SRA1016574 |
| Genome ID | SRR027217.2805 |
| Phylum/Class | Diversity of active microbial communities in surface seawaters along a north-south transect in the South Pacific Ocean (SRP001207) |
| Species | |
| Start position on genome | 152 |
| End posion on genome | 228 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
gcgcacggtc |
| tRNA gene sequence |
CGGGGCGTGGCGCAGTCTGGTAGCGCACCTGTTTTGGGTACAGGGGGTCGTGAGTTCGAA |
| Downstream region at tRNA end position |
cttcttcttt |
| Secondary structure (Cloverleaf model) | >SRA1016574 Pro TGG
c ACCA cttcttcttt
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T C G C T C A
T G A G | + | | | G
C C G C G G T G A G C
T | | | | T T
G G C G C
G T A A GGGTC
C - G
C - G
T - A
G - C
T - A
T T
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |