Sequence ID | >SRA1016576 |
Genome ID | SRR027355.554 |
Phylum/Class | Investigation of prokaryote diversity in the sub-seafloor biosphere by 16S rRNA gene tag (V6) sequencing (SRP001218) |
Species | |
Start position on genome | 22 |
End posion on genome | 112 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
attcaacgcc |
tRNA gene sequence |
GGAGAGGTGGCAGAGCGGTTGAATGCACTGGTCTTGAAAACCAGCAAGGGTTTGTGGCCC |
Downstream region at tRNA end position |
cttattggca |
Secondary structure (Cloverleaf model) | >SRA1016576 Ser TGA c GCCA cttattggca G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | | | | | G G G A C G G A G G G C G | | | T T T A T G C T G A A CAAGGGTTTGTGGCCCTTC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |