Sequence ID | >SRA1016580 |
Genome ID | SRR027355.36724 |
Phylum/Class | Investigation of prokaryote diversity in the sub-seafloor biosphere by 16S rRNA gene tag (V6) sequencing (SRP001218) |
Species | |
Start position on genome | 19 |
End posion on genome | 106 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgaattcaac |
tRNA gene sequence |
GCCGGAGTGGTGAAACTGGTAGACGCGCTGGACTCAAAATCCAGCGGGGGGCAACCCCGT |
Downstream region at tRNA end position |
ttatttatct |
Secondary structure (Cloverleaf model) | >SRA1016580 Leu CAA c ACCA ttatttatct G - C C - G C - G G - C G - C A - T G - C T T T C A G C C A C A A G | | | | | G T A G T G G T C G G C G | + | T T G A C G C T A G G CGGGGGGCAACCCCGT C - G T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |