Sequence ID | >SRA1016582 |
Genome ID | SRR027355.49284 |
Phylum/Class | Investigation of prokaryote diversity in the sub-seafloor biosphere by 16S rRNA gene tag (V6) sequencing (SRP001218) |
Species | |
Start position on genome | 21 |
End posion on genome | 103 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gatcaacgcc |
tRNA gene sequence |
GGGCATGTGGCGGAATGGCAGACGCACAGGACTTAAAATCCTGTTCGCTTCGGCGAGTGT |
Downstream region at tRNA end position |
tttaaatcct |
Secondary structure (Cloverleaf model) | >SRA1016582 Leu TAA c Aggt tttaaatcct G - C G - C G - C C - G A - T T - A G - C T G T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T C A C G C A G A TTCGCTTCGGCGAGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |