Sequence ID | >SRA1016630 |
Genome ID | SRR027369.32567 |
Search identical group | |
Phylum/Class | Analysis of diversity of coastal microbial mats using 454 technology (SRP001219) |
Species | |
Start position on genome | 159 |
End posion on genome | 234 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaatcgtatg |
tRNA gene sequence |
GCGGGCGTAGCCAAGTGGTTAAGGCAGTGGATTGTGGTTCCACCATTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
ttcgtaaacc |
Secondary structure (Cloverleaf model) | >SRA1016630 His GTG g CCTA ttcgtaaacc G - C C - G G - C G + T G + T C - G G - C T G T T A C C C A T G A A + | | | | G G A C C G G T G G G C G | | | T T T A G G C T A A CATTC G - C T - A G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |