Sequence ID | >SRA1016674 |
Genome ID | SRR028015.17975 |
Search identical group | |
Phylum/Class | Microbial Census of Marine Methane Seeps: Initial Results (SRP001268) |
Species | |
Start position on genome | 137 |
End posion on genome | 64 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gagagcaagT |
tRNA gene sequence |
GGGCTCGTAGCTCAGTGGAAGAGCGCCGCCTTCGCGAGGCGGAGGCCACGGGTTCAAATC |
Downstream region at tRNA end position |
gaaatagcgg |
Secondary structure (Cloverleaf model) | >SRA1016674 Ala CGC T ATgt gaaatagcgg G - C G - C G + T C - G T - A C - G G - C T A T T G C C C A G A A | | | | | A T C T C G A C G G G C G | | | | T T G G A G C A A G AGGCC C - G C - G G - C C - G C - G T A T G C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |