Sequence ID | >SRA1016854 |
Genome ID | SRR035082.42983 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 201 |
End posion on genome | 272 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tttacaataa |
tRNA gene sequence |
GCGTCTTTAGCTCATTGGGAGAGCACTCGGTTTGCATCCGAGGTGTACGGGGTTCGATAC |
Downstream region at tRNA end position |
cgaaattctg |
Secondary structure (Cloverleaf model) | >SRA1016854 Ala TGC a Aaag cgaaattctg G + T C - G G - C T - A C - G T - A T - A A T T G T A C C A T A A | + | | G T C T C G C G G G G C G | | | | T T G G A G C G A A GTGTA C - G T - A C - G G - C G - C T T T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |