| Sequence ID | >SRA1016917 |
| Genome ID | SRR035082.52806 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 332 |
| End posion on genome | 260 |
| Amino Acid | Arg |
| Anticodon | TCG |
| Upstream region at tRNA start position |
attaaaatat |
| tRNA gene sequence |
GCCCTCGTGGTGAAATGGATATCATCTTTGTCTTCGGAACAAAGGGTAGGGGTTCGAGTC |
| Downstream region at tRNA end position |
aagtagttct |
| Secondary structure (Cloverleaf model) | >SRA1016917 Arg TCG
t ACat aagtagttct
G - C
C - G
C - G
C - G
T - A
C - G
G - C T G
T T C T C C A
T A A G | | + | | G
G A G T G A G G G G C
G | | | + T T
A T C A T
T A C GGGT
T - A
T - A
T - A
G - C
T - A
C A
T G
T C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |