Sequence ID | >C151000229 |
Genome ID | AP012323 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium bifidum ATCC 29521 = JCM 1255 = DSM 20456 [AP012323] |
Start position on genome | 2031649 |
End posion on genome | 2031576 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tggtaatgtt |
tRNA gene sequence |
GCCCCTTTAGCTCAACGGTTAGAGCAGCGTCCTTTTAAGTCGTGGGTTGTGGGTTCGAAT |
Downstream region at tRNA end position |
ttaagtcctt |
Secondary structure (Cloverleaf model) | >C151000229 Lys TTT t ACgg ttaagtcctt G - C C - G C - G C - G C - G T + G T - A T A T C A C C C A C A A A | | | | | G G C T C G G T G G G C G | | | | T T T G A G C T A A GGGTT G + T C - G G - C T T C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |