Sequence ID | >SRA1017045 |
Genome ID | SRR035082.72188 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 324 |
End posion on genome | 400 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
atgttaagtt |
tRNA gene sequence |
GGGCGATTAGTTCAGTTGGCTAGAATGCCTGGTTTACACCCAGGAGATCGTAGGTTCGAG |
Downstream region at tRNA end position |
aaatctgctt |
Secondary structure (Cloverleaf model) | >SRA1017045 Val TAC t ACCA aaatctgctt G - C G - C G - C C - G G - C A - T T - A T G T C A T C C A T G A A | | | | | G T C T T G G T A G G C G | | | + T T G G A A T C T A G AGATC C - G C - G T - A G - C G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |