Sequence ID | >C151002561 |
Genome ID | AP014624 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Chryseobacterium sp. StRB126 [AP014624] |
Start position on genome | 724464 |
End posion on genome | 724539 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tccgcactat |
tRNA gene sequence |
GCGAAAATAGCTCAGCTGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
caccatgccc |
Secondary structure (Cloverleaf model) | >C151002561 Gly GCC t TCCA caccatgccc G - C C - G G - C A - T A - T A - T A - T T A T T G C C C A C G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |