Sequence ID | >SRA1017253 |
Genome ID | SRR035082.106227 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 133 |
End posion on genome | 207 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ctgccaacat |
tRNA gene sequence |
GCGCGGTTGGTCTAATGGCTATGATACTTGTTTGTCGAACAAGAGATACGGGTTCAATTC |
Downstream region at tRNA end position |
aatacaacaa |
Secondary structure (Cloverleaf model) | >SRA1017253 Asp GTC t GCCA aatacaacaa G - C C - G G - C C - G G + T G - C T - A T T T T G C C C A T A A G | | | | | A G T C T G A C G G G C G | | + T T C T G A T T A A AGAT C - G T - A T - A G - C T - A T A T G G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |