| Sequence ID | >SRA1017334 |
| Genome ID | SRR035082.120283 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 62 |
| End posion on genome | 136 |
| Amino Acid | Arg |
| Anticodon | GCG |
| Upstream region at tRNA start position |
aacttatcaa |
| tRNA gene sequence |
GTCCTCATAGTTCAACGGATAGAACGTGAGATTGCGGATCTTAAGATCCAGGTTCGATTC |
| Downstream region at tRNA end position |
ttttttcatc |
| Secondary structure (Cloverleaf model) | >SRA1017334 Arg GCG
a ACAA ttttttcatc
G - C
T + G
C - G
C - G
T - A
C - G
A - T T T
T G G T C C A
C A A A | | | | | G
G C T T G C C A G G C
G | | | | T T
A G A A C
T A G AGAT
T - A
G + T
A - T
G - C
A - T
T A
T G
G C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |