Sequence ID | >SRA1017349 |
Genome ID | SRR035082.123887 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 443 |
End posion on genome | 368 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gccgtctgtc |
tRNA gene sequence |
TCCGGGGTAGTTGAGTTGGTACAACGCCACGCTGTTAACGTGGATATCGCAGGTTCGAAT |
Downstream region at tRNA end position |
ggcggctaac |
Secondary structure (Cloverleaf model) | >SRA1017349 Asn GTT c GCCA ggcggctaac T - A C - G C - G G - C G - C G - C G - C T A T C G T C C A T G A A | | | | | G T G T T G G C A G G C G | | | | T T G C A A C T A G ATATC C - G C - G A - T C - G G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |