Sequence ID | >C151004102 |
Genome ID | CP003182 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Granulibacter bethesdensis CGDNIH4 [CP003182] |
Start position on genome | 297606 |
End posion on genome | 297532 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ggtcacggat |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGAGGGTTCGAATC |
Downstream region at tRNA end position |
gttttttaaa |
Secondary structure (Cloverleaf model) | >C151004102 Gly GCC t TCCA gttttttaaa G - C C - G G - C G - C G - C C - G G - C T A T T T C C C A G A A + | | | | G G C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |