Sequence ID | >SRA1017370 |
Genome ID | SRR035082.127853 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 294 |
End posion on genome | 209 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
actttgtcga |
tRNA gene sequence |
GCGGATGTGGCGGAATTGGTATACGCACAGGCTTGAGGAGCCTGCCTCGCAAGAGGGTGG |
Downstream region at tRNA end position |
tacagaactt |
Secondary structure (Cloverleaf model) | >SRA1017370 Leu GAG a ACCA tacagaactt G - C C - G G - C G - C A - T T - A G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A T A CCTCGCAAGAGGGT C - G A - T G - C G - C C - G T A T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |