| Sequence ID | >SRA1017395 |
| Genome ID | SRR035082.132668 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 338 |
| End posion on genome | 412 |
| Amino Acid | Arg |
| Anticodon | GCG |
| Upstream region at tRNA start position |
taaagccaat |
| tRNA gene sequence |
GCCCTCGTAGTTTAACGGACAGAATACTAGCTTGCGGAGCTTGCGATAGAGGTTCGATTC |
| Downstream region at tRNA end position |
gatttttgtc |
| Secondary structure (Cloverleaf model) | >SRA1017395 Arg GCG
t ACCA gatttttgtc
G - C
C - G
C - G
C - G
T - A
C - G
G - C T T
T T C T C C A
C A A A | | | | | G
G T T T G A G A G G C
G + | | + T T
A G A A T
C A A CGAT
C - G
T T
A - T
G - C
C - G
T A
T G
G C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |