Sequence ID | >SRA1017414 |
Genome ID | SRR035082.135129 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 196 |
End posion on genome | 122 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tttgggtttg |
tRNA gene sequence |
GCCGATATAGCTCAGTGGTAGAGCAACTGTTTTGTAAACAGTAGGTCGTCGGTTCGAATC |
Downstream region at tRNA end position |
ttgaaatcat |
Secondary structure (Cloverleaf model) | >SRA1017414 Thr TGT g TCCA ttgaaatcat G - C C - G C - G G - C A - T T - A A - T T A T C A G C C A G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |