Sequence ID | >SRA1017440 |
Genome ID | SRR035082.139390 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 303 |
End posion on genome | 380 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
accatttttc |
tRNA gene sequence |
GGGCGCGTATCTCAGTTGGTTTAGAGCGCCTGCTTTACAAGCAGGATATCGTAGGTTCGA |
Downstream region at tRNA end position |
aattttgaaa |
Secondary structure (Cloverleaf model) | >SRA1017440 Val TAC c ACCA aattttgaaa G + T G - C G - C C - G G + T C - G G - C T A T C A T C C A T T G A A | | | | | G G C T C T G T A G G C G | | | T T T G A G C T T A G ATATC C - G C - G T - A G - C C - G T A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |