Sequence ID | >SRA1017459 |
Genome ID | SRR035082.143344 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 159 |
End posion on genome | 77 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agaaagttct |
tRNA gene sequence |
GCGGATGTGGCGGAACTGGCAGACGCGTTGGATTTAGGATCCAATGAGGAAACTCGTGTG |
Downstream region at tRNA end position |
atctccttga |
Secondary structure (Cloverleaf model) | >SRA1017459 Leu TAG t ACac atctccttga G - C C - G G - C G - C A - T T - A G - C T A T C A C C C A C A A G | | | | | A T G G C G G T G G G C G | | | T T G A C G C C A G G TGAGGAAACTCGT T - A T - A G - C G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |