Sequence ID | >SRA1017472 |
Genome ID | SRR035082.145308 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 411 |
End posion on genome | 338 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
taattgaaag |
tRNA gene sequence |
GGGCCCATGGCTTAATGGTAGAGTATTGGTTTTGCATACCAAAGGTGGGAGTTCGATTCT |
Downstream region at tRNA end position |
tatttaattt |
Secondary structure (Cloverleaf model) | >SRA1017472 Ala TGC g ACAA tatttaattt G - C G - C G + T C - G C - G C - G A - T T T T C C C T C A A A G | | | | | G T T T C G G G G A G C G + | | + T T G G A G T T A A AGGT T - A T - A G - C G - C T - A T T T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |