| Sequence ID | >SRA1017589 |
| Genome ID | SRR035082.164132 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 314 |
| End posion on genome | 242 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
agtacaagac |
| tRNA gene sequence |
GGGGCATTCGTCTAGTGGTTAGGACATCGGACTTTCGATCCGACAACAGGGGTTCGACTC |
| Downstream region at tRNA end position |
aagcgcctaa |
| Secondary structure (Cloverleaf model) | >SRA1017589 Glu TTC
c ACtt aagcgcctaa
G - C
G + T
G - C
G - C
C - G
A - T
T - A T C
T T C C C C A
T G A C | | | | | G
G T C T G A G G G G C
G + | | | T T
T G G A C
T A A CAAC
T - A
C - G
G - C
G - C
A - T
C A
T G
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |