Sequence ID | >SRA1017592 |
Genome ID | SRR035082.164415 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 347 |
End posion on genome | 264 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cagtttatgt |
tRNA gene sequence |
GGAGAGATGGCAGAGTGGTTTATTGCGCTTGTCTTGAAAACAAGAAACCGAAAGGTTCGT |
Downstream region at tRNA end position |
aatggagaga |
Secondary structure (Cloverleaf model) | >SRA1017592 Ser TGA t GCtg aatggagaga G - C G - C A - T G - C A - T G - C A - T T A T C A T C C A T G A G | | + | | G G G A C G G T G G G C G + | | | T T T T T G C T T A G AAACCGAAAGGTTC C - G T - A T - A G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |