Sequence ID | >SRA1017775 |
Genome ID | SRR035082.194686 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 320 |
End posion on genome | 245 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
attcggttac |
tRNA gene sequence |
CGGGGTGTGGCGCAGTTGGCAGCGCGTGCGCATGGGGTGCGCAAGGTCGCCGGTTCGAGC |
Downstream region at tRNA end position |
cctttgaatt |
Secondary structure (Cloverleaf model) | >SRA1017775 Pro GGG c ACCA cctttgaatt C - G G - C G - C G - C G - C T - A G - C C G T C G G C C A T G A G | | | | | G T C G C G G C C G G C G | | | | T T G G C G C C A G AGGTC T - A G - C C - G G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |