Sequence ID | >SRA1017916 |
Genome ID | SRR035082.213777 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 81 |
End posion on genome | 7 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttgaaaataa |
tRNA gene sequence |
GCCGGGGTAGCTCAGTGGTAGAGCACTGGATTGAAAATCCAGGTGTCGGCAGTTCAATCC |
Downstream region at tRNA end position |
ttcaaannnn |
Secondary structure (Cloverleaf model) | >SRA1017916 Phe GAA a ACCA ttcaaannnn G - C C - G C - G G - C G - C G - C G - C C T T C C G T C A G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T A A GTGTC C - G T - A G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |