| Sequence ID | >SRA1018003 |
| Genome ID | SRR035082.226737 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 214 |
| End posion on genome | 132 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
aaataaattt |
| tRNA gene sequence |
CGGGTAGTAGAGGAGTTTGGTTTCTCGCCACATTTGGGATGTGGGCTTTATGCATACGCA |
| Downstream region at tRNA end position |
ggccccataa |
| Secondary structure (Cloverleaf model) | >SRA1018003 Pro TGG
t ACac ggccccataa
C - G
G - C
G - C
G - C
T - A
A - T
G - C T A
T T G T C C A
T G A A + | | | | G
T G G A G G C A G G C
T + | | | T T
G T C T C
G T T G GCTTTATGCATAC
C - G
C - G
A - T
C - G
A - T
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |