Sequence ID | >SRA1018014 |
Genome ID | SRR035082.227325 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 236 |
End posion on genome | 162 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctaaaaatta |
tRNA gene sequence |
GGGCAGTTAGCTCAGTTGGTTAGAGCGCTTGGTTTACATCCATGAGGCCAGAGGTTCGAG |
Downstream region at tRNA end position |
aatttatcgg |
Secondary structure (Cloverleaf model) | >SRA1018014 Val TAC a ACtt aatttatcgg G - C G - C G - C C - G A - T G - C T - A T G T T C T C C A T G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C T T A G AGGCC C - G T T T - A G - C G - C T T T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |