Sequence ID | >SRA1018217 |
Genome ID | SRR035082.257135 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 199 |
End posion on genome | 272 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aattatttta |
tRNA gene sequence |
GGGGGCATAGCTCAGTGGTTTAGAGCTTCTGTTTTACGCGCAGAGAGTCGGGGGTTCGAT |
Downstream region at tRNA end position |
aaattaaagt |
Secondary structure (Cloverleaf model) | >SRA1018217 Val TAC a Cact aaattaaagt G - C G - C G - C G - C G + T C - G A - T T T T C T C C C A T G A A | + | | | G G C T C G G G G G G C G | | | | T T T G A G C T T A T GAGTC T - A C - G T - A G - C T + G T C T G T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |