Sequence ID | >C151012328 |
Genome ID | CP006777 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium beijerinckii ATCC 35702 SA-1 [CP006777] |
Start position on genome | 122525 |
End posion on genome | 122600 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agaataatgt |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
taaagtttag |
Secondary structure (Cloverleaf model) | >C151012328 Met CAT t ACCA taaagtttag C A G - C C - G G - C G - C G + T G - C T G T C G T C C A T G A G | + | | | A T C G A G G T A G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |