Sequence ID | >SRA1018233 |
Genome ID | SRR035082.259071 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 364 |
End posion on genome | 290 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atcntaaaaa |
tRNA gene sequence |
GGCTGGGTAGCTCAGTTGGTTAGAGCATAGCACTCATAACGCTAAGGTCGCGGGTTCGAT |
Downstream region at tRNA end position |
ttttattatg |
Secondary structure (Cloverleaf model) | >SRA1018233 Met CAT a ACat ttttattatg G - C G - C C - G T C G - C G - C G - C C T T C G C C C A T G A A | | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A A AGGTC T - A A - T G - C C - G A C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |