| Sequence ID | >SRA1018329 |
| Genome ID | SRR035082.273869 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 77 |
| End posion on genome | 1 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
taattataat |
| tRNA gene sequence |
CGGGGTGTAGGCTAGTGGAAAGAGTCGCTCGGTTTGGGACCGAGAATACGGGGGTTCGAG |
| Downstream region at tRNA end position |
nnnnnnnnnn |
| Secondary structure (Cloverleaf model) | >SRA1018329 Pro TGG
t ACCA nnnnnnnnnn
C - G
G - C
G - C
G - C
G - C
T T
G - C T G
T C T C C C A
T G A A | + | | | G
G T C G G G G G G G C
G | | + | T T
A A G T C
A A G G AATAC
C - G
T - A
C - G
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |