Sequence ID | >SRA1018443 |
Genome ID | SRR035082.292225 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 170 |
End posion on genome | 94 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aaaagtttat |
tRNA gene sequence |
CTCGGTGTAGGCCAGTCTGGTAGGTCACTCGCTTTGGAAGTGAGTCGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
atattcaacg |
Secondary structure (Cloverleaf model) | >SRA1018443 Pro TGG t ACCA atattcaacg C - G T - A C - G G - C G + T T - A G - C T A T C C T C C A T G A A | | | | | G C C C G G G G A G G C T | | + | T T G G G T C G T A A TCGTC C - G T - A C - G G + T C - G T A T A T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |