Sequence ID | >SRA1018609 |
Genome ID | SRR035082.321136 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 259 |
End posion on genome | 333 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gatttttttg |
tRNA gene sequence |
TGCTAGGTAGTTCAGTGGTAGAACGCTACGCTGTTAACGTAGATGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
ttttttaaaa |
Secondary structure (Cloverleaf model) | >SRA1018609 Asn GTT g GCCA ttttttaaaa T - A G - C C - G T - A A - T G - C G - C T A T C G A C C A G A A | | | | | G T C T T G G C T G G C G | | | | T T G G A A C T A G ATGTC C - G T - A A - T C - G G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |